Infrared (810 nm) Low-level Laser Therapy in Rat Achilles Tendinitis: A Consistent Alternative to Drugs [Photochemistry and Photobiology]

ABSTRACT

Nonsteroidal anti-inflammatory drugs (NSAIDs) are widely used and can reduce musculoskeletal pain in spite of the cost of adverse reactions like gastrointestinal ulcers or cardiovascular events. The current study investigates if a safer treatment such as low-level laser therapy (LLLT) could reduce tendinitis inflammation, and whether a possible pathway could be through inhibition of either of the two-cyclooxygenase (COX) isoforms in inflammation. Wistar rats (six animals per group) were injected with saline (control) or collagenase in their Achilles tendons. Then, we treated them with three different doses of IR LLLT (810 nm; 100 mW; 10 s, 30 s and 60 s; 3.57 W cm-2; 1 J, 3 J, 6 J) at the sites of the injections, or intramuscular diclofenac, a nonselective COX inhibitor ? NSAID. We found that LLLT dose of 3 J significantly reduced inflammation through less COX-2-derived gene expression and PGE2 production, and less edema formation compared to nonirradiated controls. Diclofenac controls exhibited significantly lower PGE2 cytokine levels at 6 h than collagenase control, but COX isoform 1-derived gene expression and cytokine PGE2 levels were not affected by treatments. As LLLT seems to act on inflammation through a selective inhibition of the COX-2 isoform in collagenase-induced tendinitis, LLLT may have potential to become a new and safer nondrug alternative to coxibs.

INTRODUCTION

Tendinitis and other tendinopathies are among the most prevalent musculoskeletal disorders in modern society and they are commonly treated with anti-inflammatory pharmacological agents in primary health care (1,2). Intrinsic risk factors for tendinopathies. are middle or older age (3). diabetes (4) and antibiotic treatment (5). while extrinsic risk factors include high-frequency of work-related repetitive movements in non-neutral positions (6).

For acute and subacute tendinitis there is consensus that the aim of therapy should be targeted at reducing inflammation and edema (7). Short-term effects in tendinitis have been observed for pharmacotherapies such as nonsteroidal anti-inflammatory drugs (8) and glucocorticoid injections (9). However, experimental studies have found that these pharmaceutical agents may negatively affect the healing process after acute tendon injuries (10-14). In this perspective, there is a need for investigating nonpharmacological alternatives to examine if they can modulate the acute inflammatory tendinitis response with less adverse effects than drugs.

Loading of tendon cells seems to increase the expression of cyclooxygenase-2 (COX-2) and consequently the release of prostaglandin E2 (PGE2). In a human experimental model of healthy Achilles tendons, peritendinous PGE2 concentrations seemed to increase as a response to tendon loading (15). This activity-induced release of PGE2 could in turn be blocked by a COX-2 inhibitor (celecoxib) (16), However. there is little direct "in vivo" evidence concerning COX-2 gene expression in tendons and its time profile after an inflammatory stimulus.

Collagenase is known to have both proinflammatory and degenerative properties and it has previously been used to induce acute tendinitis in animal models (17.18). These studies found inflammatory cell migration and edema during the first days after injection (19.20), but the kinetic profile of the inflammatory process in this model of collagenase-induced tendinitis is not yet determined.

Low-level laser therapy (LLLT) has been used with mixed results in clinical studies of acute tendinitis and other tendinopathies for the last three decades, but the mechanisms involved are not well understood. In a previous review of the application of LLLT in tendinopathy treatments, we pointed out that several mechanisms could account for the positive results (21). One possible underlying mechanism is a modulation of the inflammatory process. In a previous study, we observed that specific doses of LLLT reduced acute rat paw edema to approximately the same level as a human equipotent dose of the nonsteroidal anti-inflammatory drug diclofenac (22). This finding has been supported by similar macroscopic and histological findings in other animal models comparing LLLT and tenoxicam (23), meloxicam (24) and celecoxib (25). In a human model of activating Achilles tendinitis by overload, we found that PGE2 was reduced by LLLT, but if and how LLLT act on COX isoforms remains uncertain. In this study, we aim at mapping the short-term time profile of rat collagenase-induced tendinitis and to measure the gene expressions of the COX isoforms and their respective prostaglandin PGE2 production in tendons. In addition, we sought to investigate if LLLT could affect the inflammatory process in rat Achilles tendons.

MATERIALS AND METHODS

All of the experimental procedures were submitted and approved by the Ethical Committee of the University of Sao Paulo. One hundred and fifty male Wistar rats weighing about 250 g were randomly divided and housed five per cage before the experimental procedure. Food and water were provided ad libitum throughout the experiment. Rats were anesthetized with inhalatory halothane before collagenase injection. All the necessary preoperative procedures were performed in order to prevent discomfort and to avoid any infection. Skin was surgically prepared and the collagenase (30 µL of crude collageuase-1 mg mL-1; Sigma, St. Louis, MO; Cat# C-6885-using a 30 G needle) was injected percutaneously parallel to the right Achilles tendon ca 2 mm above the osteotendinous junction under anesthesia. Collagenase was dissolved in sterile PBS containing 50 nM NaH2 PO4, 10 mM NaCl at pH 7.1. The same volume of PBS without collagenase was injected using the same procedure in a control group of six animals. In another control group of six animals, a prefabricated solution of diclofenac I mg kg-1 rat bodyweight was injected in the abdomen 30 min prior to the collagenase injection.

Animals were sacrificed with an overdose of halothane at the different outcome timepoints (2, 4, 6, 12, 24, 48 and 72 h, 7 and 14 days). After the removal of skin and connective tissue. Achilles tendons were removed and processed for further analysis.

LLLT procedure. A single LLLT was performed 1 h after collagenase injection with an IR laser unit (DMC, Sao Carlos, Brazil). The laser unit emitted a continuous optical output of 100 mW with a wavelength of 810 nm to a spot size area of 0.028 cm2, which gave a power density of 3.57 W cm-2. The optical output of the laser unit was measured before, halfway through and after the experiment. Laser irradiation was performed in skin contact at the site of collagenase injection with doses of 1 J (35.71 J cm-2), 3 J (107.14 J cm-2) and 6 J (214.29 J cm-2) and corresponding irradiation times of 10, 30 and 60 s. respectively. The laser energy doses were chosen according to previous studies of our research group (22,25).

Analyses. For all analyses we used a sample of six animals. An observer who was blinded to group allocation performed all analyses. Initial analysis was performed at Section of Pharmacology, ICB at University of Sao Paulo, Brazil. To insure consistency in analyses and reproducibility of results, two other laboratories at University of Sao Paulo (Brazil) duplicated the analyses.

RNA isolation and Real Time PCR analysis: At the selected time-points Achilles tendons were dissected, frozen in liquid nitrogen, and stored at -80°C. Total RNA was isolated in the Trizol reagent, according to the manufacturer's instruction.

DNase I was employed to digest DNA to obtain RNA purification and the integrity of RNA was verified by agarose gel electrophoresis. Total RNA (2 µg) was used for first-strand cDNA synthesis (reverse transcriptase [RT]) using SuperScript II. In addition, RNaseOUT was also added to protect the RNA during this process. Three pooled RNA aliquots were routinely sham reverse transcribed (i.e. RT omitlea) to insure the absence of DNA contaminants. Diluted RT samples (1:10) were submitted to real-time PCR amplification using Platinum Sybr QPCR Supermix-UDG and specific oligonucleotides for COX-I (forward: CCGTGCGAGTACAGTCACAT; reverse: CCTCACCAG TCATTCCCTGT) and COX 2 (forward: AGATCAGAAGCGAG GACCTG: reverse: CCATCCTGGAAAAGTCGAAG).

Beta-actin was used as an internal control (forward: AAGATTTG GCACCACACTTTCTACA; reverse: CGGTGAGCAGCACAGG GT).

The conditions for PCR were as follows: 50°C-2 min; 95°C-2 rain, followed by 30 cycles of 95°C-15 s; 60°C-1 min and 72°C-15 s. Ct values were recorded for each gene, and the results of genes of interest were normalized to results obtained with the internal control gene. ddCT were calculated and the results are expressed as fold increase. All oligonucleotides and reagents utilized in this protocol were purchased from Invitrogen Co.

PGE1 -production derived from each COX isoform: PGE2 generation was analyzed and determined according to the manufacturer instructions by ELISA (R & D Systems, Minneapolis, MN). In order to separate the two-COX isoforms, we used indomethacin as a nonspecific inhibitor and etoricoxib as a selective COX-2 inhibitor (26). The amount of PGE2 production derived from each isoform was then calculated according to the difference between complete inhibition by indomethacin and partial inhibition by the selective COX-2 inhibitor etoricoxib.

Vascular permeability-Evans Blue: An Evans Blue dye (25 mg mL-1; MERCK) was dissolved in saline solution and then filtered in a sterilized membrane (0.22 m; MILLIPORE) and conserved at 4°C.

The animals were previously anesthetized with halothane and then injected peritendinously with the Evans Blue dye, 1 h before euthanasia. Animals were sacrificed by halothane super dose. After the sacrifice, the tendon was collected, weighed and conserved for 24 h at 37°C in a glass tube in Formamide solution (MERCK article 9684,1000, 4 mL g-1) for dye extraction. A 150 µL sample from each tube was used for determination of Evans Blue concentrations (BIOTEK Spectrophotometer 618-620 nm). The results were analyzed by linear regression, correlation and the Tukey-Kramer multiple comparisons tests.

Edema formation-wet-dry weight measurements: After collagenase injection, the rat Achilles tendons were excised after 24 h, in order to evaluate edema formation. Tendons were dried for 48 h at 60°C and edema was then calculated from the difference between wet and dry weight, measured with a precision analytical balance (0.0001 mg sensitivity). As tendon matrix is a firm structure and the formation of edema is less prevalent than in soft tissue which is of looser structure, an extra control group receiving the nonsteroidal anti-inflammatory drug (NSAID) diclofenac was added for this comparison.

Statistical analysis. A blinded observer unaware of the allocation to groups performed the statistical analysis. Data are expressed as mean and standard error (±) of the mean (SEM). All data were statistically evaluated by analysis of variance (ANOVA), followed by the Newman-Keuls-Student's test. Values with P < 0.05 were considered to be statistically significant.

RESULTS

Characteristics of acute inflammation in the collagenase-induced tendinitis mode)

COX-1 and COX-2 gene expression by real-time PCR. There was a sharp decrease in mRNA expression for COX-I after collagenase injection at 2 h. thereafter it stabilized at a low level for the first 24 h. On the other hand, COX-2 mRNA expression increased sharply after collagenase injection and peaked at 2 h. It stayed significantly higher than baseline for the first 24 h. The results suggested that 2 h after collagenase injection would be the most suitable timepoint for measuring effects on COX-1 and COX-2 gene expression from anti-inflammatory therapies. In addition, the results suggest that anti-infiammatory effects should be expressed as an ability to increase COX-1 expression and reduce COX-2 expression at the 2 h timepoint (Fig. 1A).

Effects of low-level laser irradiation on COX-1 gene expression. All therapeutic groups exhibited highly significant increases in COX-1 mRNA expressions (P < 0.0001) compared to the collagenase control group at 2 h after collagenase injections. There were no significant differences between diclofenac and the LLLT groups (P = 0.18-0.91) (Fig. 1B).

Effects of low-level laser irradiation on COX-2 gene expression. There were no significant effects on the COX-2 gene expression at 2 h from diclofenac and LLLT with an energy dose of 1 J. LLLT with an energy dose of 6 J significantly reduced COX-2 gene expression (P < 0.05), whereas LLLT with an energy dose of 3 J induced a highly significant reduction of COX-2 gene expression (P < 0.0001) compared to the collagenase control. The LLLT with 3 J also reduced the COX-2 gene expression to a level significantly lower (P < 0.05) than the saline control (Fig. 1C).

Effects of LLLT on tendon COX-1-derived PGE2 production. Tendon tissue produced higher concentrations of COX-1-derived PGE2 than COX-2-derived PGE2 at 6 h after collagenase injections. PGE2 concentration derived from COX-1 isoform exhibited statistical significance versus saline control, while PGE2 concentration derived from COX-2 isoform was significantly different from saline (data not shown).

Neither diclofenac nor energy doses of 3 J and 6 J LLLT significantly affected PGE2 production derived from the COX-1 enzyme compared to collagenase controls. LLLT with an energy dose of 1 J significantly (*P < 0.05) increased the COX-1-derived PGE2 production (Fig. 2A).

LLLT doses of 1 J and 3 J LLLT significantly reduced PGE2 production derived from the COX-2 isoform (P = 0.001 and P = 0.01, respectivety), while 6 3 of LLLT was not significantly different (P = 0.08) from the collagenase control group (Fig. 2B).

Vascular permeability (Evans Blue Dye). The time course for vascular permeability measured by Evans Blue dye showed significantly increased permeability versus saline control. As expected, the onset for vascular extravasation was slower than for reactions related to gene expression and PGE2 production and no significant differences from saline control were seen up to the 6 h timepoint. However, vascular permeability peaked at 12 h and remained significant at 24 and 48 h (P < 0.05) after collagenase injection (Fig. 3A).

There was a significant reduction of vascular permeability and extravasation measured by Evans Blue dye at 12 h from LLLT doses of both 3 and 6 J (P < 0.05). Neither diclofenac, nor LLLT with an energy dose of 1 J, differed significantly from the collagenase control group in vascular permeability (Fig. 3B).

Edema formation in tendon tissue. Diclofenac and LLLT doses of 1 and 6 J were not significantly different from the collagenase control group in wet weight ? dry weight differences at 12 h after the collagenase injection. However, there was a significant reduction in the wet weight-dry weight difference in the group receiving LLLT with an energy dose of 3 J, and both the collagenase and diclofenac (P < 0.01) groups (Fig. 4).

DISCUSSION

In this experiment we have demonstrated that the collagenase-induced tendinitis model may be suitable for studying the sequence of acute inflammatory responses in tendon tissue. The characterization of the experimental model with collagenase-induced inflammation revealed that mRNA expression for COX-1 decreased, while mRNA COX-2 expression increased at 2 h. This finding contradicts the common opinion that anti-inflammatory effects are achieved by reducing activity in both COX isoforms. Consequently, anti-inflammatory effects from therapies on gene expression at this stage should increase COX-1 gene expression, and reduce COX-2 gene expression. At the 6 h timepoint. PGE2 production was significantly increased for both isoforms. Vascular extravasation and edema peaked at 12 h, but was not measured separately for each COX isoform. This characterization validates the use of this model to investigate possible anti-inflammatory effects of therapies at the above timepoints for maximal inflammatory expression for the respective outcomes.

In the therapeutic part of the trial, we found that gene expression of COX-1 increased significantly in all LLLT groups and also in the diclofenac control group. This finding is in line with an anti-inflammatory effect of these therapies. However, for the gene expression of COX-2, neither diclofenac control nor LLLT doses of 1 and 6 J produced anti-inflammatory effects. However, a dose of 3 J significantly reduced COX-2 gene expression. Diclofenac control and LLLT of 1 and 3 J reduced only COX-2-derived PGE2. For the macroscopic end result, vascular permeability and edema formation at 12 h were significantly reduced by LLLT with a dose of 3 J. Putting the sequences together, LLLT with a dose of 3 J exhibited the most consistent anti-inflammatory effects throughout the experiment. It was significantly superior to diclofenac for three outcomes, equal in two and inferior in one outcome.

In previous studies, LLLT has been found to be equally effective as NSAIDs in the acute inflammatory stage across several experimental models and types of NSAIDs such as indomethacin (27), diclofenac (22), meloxicam (24), tenoxicam (23) and celecoxib (25).

The least effect from LLLT was found on the tendon weight = dry weight difference, but this may be caused by the tendon tissue structure that is quite solid and allows for less expansion than looser tissue such as in the rat paw model (22). When administered orally, rofecoxib has the undesired systemic side-effect that it increases platelet aggregation and thereby increases the risk for myocardial infarct (28). Following this discovery, caution has been advocated in the systemic use of orally administered COX-2 inhibitors (29). But the enormous increase in prescription rates for COX-2 inhibitors during the first years after introduction (30) shows that there was an urgent need for finding new treatment solutions for musculoskeletal disorders with an inflammatory component. The traditional nonspecific NSAIDs have undesired side-effects on the gastro-intestinal tract (31). In addition, both COX-2 specific and nonspecific NSAIDs seem to have negative effects on the healing process of tendons (12,32). In animal studies, glucocorticoids seem to cause even more deleterious effects on tendon tissue with tendon degeneration (33) and increased apoptosis (34). Contrary to this, a number of authors have found positive effects and accelerated tendon repair after LLLT application in injured Achilles tendons of animals (35-38). This dual action of both anti-inflammatory action and enhancement of tendon repair seems to be unique to LLLT, and offers potential for refinement of LLLT dosing in clinical studies. LLLT is also well tolerated among patients with no reports of serious adverse events and the occurrence of minor side-effects being no different from placebo (39).

The collagenase-induced tendinitis is an experimental model to study tendon inflammation. However, this model may not represent exactly what happens in human pathologies, and this could be a limitation of the present study. On the other hand, our results strongly suggest a new explanation for why LLLT also seems to work with similar doses in other bodily locations such as neck pain (40,41), knee osteoarthritis (42) and hand rheumatoid arthritis (43).

CONCLUSION

In this study, we have demonstrated that the collagenase-induced tendinitis model is suitable for evaluating effects of anti-inflammatory treatments. We also found that LLLT (? = 810 nm, 100 mW) administered with an energy dose of 3 J significantly increased COX-1 gene expression, reduced COX-2 gene expression and COX-2-derived PGE2 production. vascular permeability and edema formation compared to no treatment. The effects of 3 J of LLLT were significantly better than the NSAID diclofenac in four out of five outcomes of COX-2 gene expression and edema formation, similar for vascular permeability and significantly less for inhibition of COX-2-derived PGE2.

Ethical standards-This research follows the current Brazilian laws of experiments with animals.

Conflict of interests-All the authors declare no conflict of interests related to this research.

REFERENCES

1. van der Windt, D. A., B. Koes, B. A. de Jong and L. M. Bouter (1995) Shoulder disorders in general practice: Incidence, patient characteristics an management. Ann. Rheum. Dis. 54, 959-964.

2. Smidt, N. and D. A. van der Windt (2006) Tennis elbow in primary care. BMJ 333, 927-928.

3. Fahlstrom, M., R. Lorentzon and H. Alfredson (2002) Painful conditions in the Achilles tendon region: A common problem in middle-aged competitive badminton players. Knee Surg. Sports Traumatol. Arthrose 10, 57-60.

4. Miranda. H., E. Viikari-Juntura, S. Heistaro, M. Heliovaara and H. Riihimaki (2005) A population study on differences in the determinants of a specific shoulder disorder versus nonspecific shoulder pain without clinical findings. Am. J. Epidemiol. 161, 847-855.

5. Melhus, A. (2005) Fluoroquinolones and tendon disorders. Expert Opin. Drug Saf. 4, 299-309.

6. Tanaka, S., M. Petersen and L. Cameron (2001) Prevalence and risk factors of tendinitis and related disorders of the distal upper extremity among U.S. workers: Comparison to carpal tunnel syndrome. Am. J. Ind. Med. 39, 328-335.

7. Johansson, K., L. Adolfsson and M. Foldevi (1999) Attitudes toward management of patients with subacromial pain in Swedish primary care. Fam. Pract. 16, 233-237.

8. Green, S., R. Buchbinder, L. Barnsley, S. Hall, M. White, N. Smidt and W. Assendelft (2002) Non-steroidal anti-inflammatory drugs (NSAIDs) for treating lateral elbow pain in adults. Cochrane Database Syst. Rev. 2, CD003686.

9. Smidt, N., W. J. Assendelft, D. A. van der Windt, E. M. Hay, R. Buchbinder and L. M. Bouter (2002) Corticosteroid injections for lateral epicondylitis: A systematic review. Pain 96, 23-40.

10. Riley, G. P., M. Cox, R. L. Harrall, S. Clements and B. L. Hazleman (2001) Inhibition of tendon cell proliferation and matrix glycosaminoglycan synthesis by non-steroidal anti-inflammatory drugs in vitro. J. Hand Surg. 26, 224-228.

11. Ferry, S. T., L. E. Dahners, H. M. Afshari and P. S. Weinhold (2007) The effects of common anti-inflammatory drugs on the healing rat patellar tendon. Am. J. Sports Med. 35, 1326-1333.

12. Cohen, D. B., S. Kawamura, J. R. Ehteshami and S. A. Rodeo (2006) Indomethacin and celecoxib impair rotator cuff tendon-to-bone healing. Am. J. Sports Med. 34, 362-369.

13. Akpinar, S., M. A. Hersekli, H. Demirors, R. N. Tandogan and F. Kayaselcuk (2002) Effects of methylprednisolone and betamethasone injections on the rotator cuff: An experimental study in rats. Adv. Ther. 19, 194-201.

14. Tsai, W. C. F. T. Tang, M. K. Wong and J. H. Pang (2003) Inhibition of tendon cell migration by dexamethasone is correlated with reduced alpha-smooth muscle actin gene expression: A potential mechanism of delayed tendon healing. J. Orthop. Res. 21, 265-271.

15. Langberg, H., D. Skovgaard, M. Karamouzis, J. Bulow and M. Kjaer (1999) Metabolism and inflammatory mediators in the peritendinous space measured by microdialysis during intermittent isometric exercise in humans. J. Physiol. 515, 919-927.

16. Langberg, H., R. Boushel, D. Skovgaard, N. Risum and M. Kjaer (2003) Cyclo-oxygenase-2 mediated prostaglandin release regulates blood flow in connective tissue during mechanical loading in humans. J. Physiol. 551, 683-689.

17. Marsolais, D., C. H. Cote and J. Frenette (2003) Nonsteroidal anti-inflammatory drug reduces neutrophil and macrophage accumulation but does not improve tendon regeneration. Lab. Invest. 83, 991-999.

18. Stone, D., C. Green, U. Rao, H. Aizawa, T. Yamaji, C. Niyibizi, G. Carlin and S. L. Woo (1999) Cytokine-induced tendinitis: A preliminary study in rabbits. J. Orthop. Res. 17, 168-177.

19. Wetzel, B. J., G. Nindl, J. A. Swez and M. T. Johnson (2002) Quantitative characterization of rat tendinitis to evaluate the efficacy of therapeutic interventions. Biomed. Sci. Instrum. 38, 157-162.

20. Marsolais, D., C. H. Cote and J. Frenette (2001) Neutrophils and macrophages accumulate sequentially following Achilles tendon injury. J. Orthop. Res. 19, 1203-1209.

21. Bjordal, J. M., C. Couppé and A. E. Ljunggreen (2001) Low level laser therapy for tendinopathy. Evidence of a dose-response pattern. Phys. Ther. Rev. 6, 91-99.

22. Albertini, R., F. S. Aimbire, F. I. Correa, W. Ribeiro, J. C. Cogo, E. Antunes, S. A. Teixeira, G. De Nucci, H. C. Castro-Faria-Neto, R. A. Zangaro and R. A. Lopes-Martins (2004) Effects of different protocol doses of low power gallium-aluminum-arsenate (Ga-Al-As) laser radiation (650 nm) on carrageenan induced rat paw ooedema. J. Photochem. Photobiol. B 74, 101-107.

23. Ulugol, A., H. Unalan, I. Dokmeci and S. Kokino (1997) Comparison of the effects of tenoxicam and mid-laser irradiation on chronic adjuvant arthritis in rats. Clin. Exp. Rheumatol. 15, 83-86.

24. Campana, V. R., M. Moya, A. Gavotto, F. Soriano, H. O. Juri, L. S. Spitale, J. C. Simes and J. A. Palma (1999) The relative effects of HeNe laser and meloxicam on experimentally induced inflammation. Laser Ther. 11, 36-41.

25. Aimbire, F., R. A. Lopes-Martins, R. Albertini, M. T. Pacheco, H. C. Castro-Faria-Neto, P. S. Martins and J. M. Bjordal (2007) Effect of low-level laser therapy on hemorrhagic lesions induced by immune complex in rat lungs. Photomed. Laser Surg. 25, 112-117.

26. Ajuebor, M. N., A. Singh and J. L. Wallace (2000) Cyclooxygenase-2-derived prostaglandin D(2) is an early anti-inflammatory signal in experimental colitis. Am. J. Physiol. Gastrointest. Liver Physiol. 279, G238-G244.

27. Honmura, A., A. Ishii, M. Yanase, J. Obata and E. Haruki (1993) Analgesic effect of Ga-Al-As diode laser irradiation on hyperalgesia in carrageenin-induced inflammation. Lasers Surg. Med. 13, 463-469.

28. Juni, P., L. Nartey, S. Reichenbach, R. Sterchi, P. A. Dieppe and M. Egger (2004) Risk of cardiovascular events and rofecoxib: Cumulative meta-analysis. Lancet 364, 2021-2029.

29. Zhang, W., R. W. Moskowitz, G. Nuki, S. Abramson, R. D. Altman, N. Arden, S. Bierma-Zeinstra, K. D. Brandt, P. Croft, M. Doherty, M. Dougados, M. Hochberg, D. J. Hunter, K. Kwoh, L. S. Lohmander and P. Tugwell (2008) OARSI recommendations for the management of hip and knee osteoarthritis, part II: OARSI evidence-based, expert consensus guidelines. Osteoarthr. Cartil. 16, 137-162.

30. Rawson, N. S., P. Nourjah, S. C. Grosser and D. J. Graham (2005) Factors associated with celecoxib and rofecoxib utilization. Ann. Pharmacother. 39, 597-602.

31. Goldstein, J. L., F. E. Silverstein, N. M. Agrawal, R. C. Hubbard, J. Kaiser, C. J. Maurath, K. M. Verburg and G. S. Geis (2000) Reduced risk of upper gastrointestinal ulcer complications with celecoxib, a novel COX-2 inhibitor. Am. J. Gastroenterol. 95, 1681-1690.

32. Dimmen, S., L. Engebretsen, L. Nordsletten and J. E. Madsen (2009) Negative effects of parecoxib and indomethacin on tendon healing: An experimental study in rats. Knee Surg. Sports Traumatol. Arthrosc. 17, 835-839.

33. Tatari, H., C. Kosay, O. Baran, O. Ozcan and E. Ozer (2001) Deleterious effects of local corticosteroid injections on the Achilles tendon of rats. Arch. Orthop. Trauma Surg. 121, 333-337.

34. Hossain, M. A., J. Park, S. H. Choi and G. Kim (2008) Dexamethasone induces apoptosis in proliferative canine tendon cells and chondrocytes. Vet. Comp. Orthop. Traumatol. 21, 337342.

35. Elwakil, T. F. (2006) An in-vivo experimental evaluation of He-Ne laser photostimulation in healing Achilles tendons. Lasers Med. Sci. 22, 53-59.

36. Fillipin, L. I., J. L. Mauriz, K. Vedovelli, A. J. Moreira, C. G. Zettler, O. Lech, N. P. Marroni and J. Gonzalez-Gallego (2005) Low-level laser therapy (LLLT) prevents oxidative stress and reduces fibrosis in rat traumatized Achilles tendon. Lasers Surg. Med. 37, 293-300.

37. Reddy, G. K., L. Stehno-Bittel and C. S. Enwemeka (1998) Laser photostimulation of collagen production in healing rabbit Achilles tendons. Lasers Surg. Med. 22, 281-287.

38. Salate, A. C., G. Barbosa, P. Gaspar, P. U. Koeke, N. A. Parizotto, B. G. Benze and D. Foschiani (2005) Effect of In-Ga-Al-P diode laser irradiation on angiogenesis in partial ruptures of Achilles tendon in rats. Photomed. Laser Surg. 23, 470-475.

39. Bjordal, J. M., R. A. Lopes-Martins, J. Joensen, A. E. Ljunggren, C. Couppe, A. Stergioulas and M. I. Johnson (2008) A systematic review with procedural assessments and meta-analysis of low level laser therapy in lateral elbow tendinopathy (tennis elbow). BMC Musculoskelet Disord. 9, 75.

40. Gross, A. R., C. Goldsmith, J. L. Hoving, T. Haines, P. Peloso, P. Aker, P. Santaguida and C. Myers (2007) Conservative management of mechanical neck disorders: A systematic review. J. Rheumatol. 34, 1083-1102.

41. Chow, R. T., M. I. Johnson, R. A. Lopes-Martins and J. M. Bjordal (2009) Efficacy of low-level laser therapy in the management of neck pain: A systematic review and meta-analysis of randomised placebo or active-treatment controlled trials. Lancet 374, 1897-1908.

42. Bjordal, J. M., M. I. Johnson, R. A. Lopes-Martins, B. Bogen, R. Chow and A. E. Ljunggren (2007) Short-term efficacy of physical interventions in osteoarthritic knee pain. A systematic review and meta-analysis of randomised placebo-controlled trials. BMC Musculoskelet Disord. 8, 51.

43. Brosseau, L., V. Welch, G. Wells, R. deBie. A. Gam, K. Harman, M. Morin, B. Shea and P. Tugwell (2000) Low level laser therapy (classes I, II and III) for the treatment of osteoarthritis. Cochrane Database Syst. Rev. 2. CD002046.

Rodrigo Labat Marcos1, Ernesto Cesar Pinto Leal Junior2, Felipe de Moura Messias2, Maria Helena Catelli de Carvalho3, Rodney Capp Pallotta1, Lúcio Frigo4, Rosângela Aparecida dos Santos3, Luciano Ramos1, Simone Teixeira1, Jan Magnus Bjordal5 and Rodrigo Álvaro Brandäo Lopes-Martins*1,2

1 Laboratory of Pharmacology and Experimental Therapeutics, Department of Pharmacology, Institute of Biomedical Sciences, University of São Paulo, São Paulo, SP-Brazil

2 Post Graduate Program in Rehabilitation Sciences, Nove de Julho University (UNINOVE), São Paulo, SP-Brazil

3 Laboratory of Hypertension, Department of Pharmacology, Institute of Biomedical Sciences, University of São Paulo, São Paulo, SP-Brazil

4 Biological Sciences and Health Center, Cruzeiro do Sul University, São Paulo, SP-Brazil

5 Section of Evidence Based Practice, Bergen University College, Bergen, Norway

Received 1 August 2011, accepted 1 September 2011, DOI: 10.1111/j.1751-1097.2011.00999.x

* Corresponding author email: [email protected] (Rodrigo Állvaro Brandão Lopes-Martins)

© 2011 The Authors

Photochemistry and Photobiology © 2011 The American Society of Photobiology 0031-8655/11